Genomic Analysis Example
This example demonstrates how to use Kwasa-Kwasa’s genomic extension to analyze DNA sequences. It shows various operations including finding open reading frames, calculating GC content, motif searching, and sequence manipulations.
Source Code
// Example of genomic sequence analysis using Turbulance
// Define a DNA sequence
item dna_sequence = "ATGCCCGGGTAATCGGTAACGGCTAGCATTGCATGCATCGA"
// Function to find open reading frames
funxn find_orfs(sequence):
// Split the sequence into codons
item codons = sequence / "codon"
item orfs = []
within sequence:
// Find start codons (ATG)
given contains("ATG"):
item start_pos = index_of("ATG")
item orf = extract_from(start_pos)
// Ensure it has a valid length
given len(orf) >= 6 and len(orf) % 3 == 0:
// Check for stop codons
given not contains(["TAA", "TAG", "TGA"]):
orfs.append(orf)
return orfs
// Function to calculate GC content
funxn gc_content(sequence):
item gc_count = 0
within sequence as nucleotides:
given nucleotide in ["G", "C"]:
gc_count = gc_count + 1
return gc_count / len(sequence)
// Function to find motifs
funxn find_motifs(sequence, motif_pattern):
item locations = []
item current_pos = 0
while current_pos < len(sequence):
item found_at = sequence.find(motif_pattern, current_pos)
given found_at != -1:
locations.append(found_at)
current_pos = found_at + 1
given otherwise:
break
return locations
Code Explanation
1. DNA Sequence Analysis Functions
Finding Open Reading Frames (ORFs)
funxn find_orfs(sequence):
// Split the sequence into codons
item codons = sequence / "codon"
// ...
The find_orfs function:
- Splits DNA into codons (3-nucleotide units)
- Looks for start codons (ATG)
- Checks for valid ORF length
- Ensures no stop codons in the reading frame
GC Content Calculation
funxn gc_content(sequence):
item gc_count = 0
within sequence as nucleotides:
given nucleotide in ["G", "C"]:
gc_count = gc_count + 1
This function:
- Iterates through nucleotides
- Counts G and C bases
- Returns the GC percentage
Motif Finding
funxn find_motifs(sequence, motif_pattern):
// ...
Searches for specific DNA patterns and returns their positions.
2. Sequence Operations
The example demonstrates various sequence operations:
// Addition: concatenation
item combined_exons = exon1 + exon2
// Division: split by pattern
item fragments = dna_sequence / "GGT"
// Multiplication: special joining (recombination)
item recombined = exon1 * exon2
// Subtraction: remove pattern
item filtered = dna_sequence - "GGT"
3. Gene Regulation Analysis
proposition GeneRegulation:
motion Activation("Gene X activates Gene Y through binding site GGTA")
motion Inhibition("Gene Z inhibits Gene X when bound to sequence ATGC")
within dna_sequence:
given contains("GGTA"):
print("Found activation site for Gene Y")
This section demonstrates:
- Modeling gene regulatory networks
- Binding site analysis
- Regulatory motif detection
4. Advanced Pattern Analysis
funxn analyze_pattern_frequencies(sequence, pattern_size=3):
item patterns = sequence / pattern_size
// ...
Features:
- K-mer frequency analysis
- Shannon entropy calculation
- Pattern distribution analysis
Running the Example
- Save the code in a file with
.turbextension - Run using the Kwasa-Kwasa interpreter:
kwasa run genomic_analysis.turb
Expected Output
Found 2 open reading frames
GC content: 52.50%
Found motif GGTA at positions: [8, 15]
Combined exons: ATGCCCGGGGCTAGCATT
Fragments after splitting by GGT: ["AT", "AACGGCTAGCATTGCATGCATCGA"]
Found activation site for Gene Y
Sequence entropy: 4.32 bits
Top 3 most common patterns:
GCT occurs 2 times
ATG occurs 2 times
GGT occurs 2 times
Key Concepts Demonstrated
- Sequence Analysis:
- Open Reading Frame detection
- GC content calculation
- Motif searching
- Pattern frequency analysis
- Mathematical Operations:
- Sequence concatenation (
+) - Pattern-based splitting (
/) - Recombination (
*) - Pattern removal (
-)
- Sequence concatenation (
- Biological Concepts:
- Gene regulation
- DNA motifs
- Sequence patterns
- Codon analysis
- Advanced Features:
- Pattern frequency analysis
- Information entropy
- Reverse complement
- Regulatory network modeling